If the sequence of one strand of DNA is | Class 12 Biology Chapter Molecular Basis of Inheritance, Molecular Basis of Inheritance NCERT Solutions

Q3. If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5→3 direction

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3’

👍 0
👎 0
✍️ Add Answer
🚩 Report

Study Tips for Answering NCERT Questions:

NCERT questions are designed to test your understanding of the concepts and theories discussed in the chapter. Here are some tips to help you answer NCERT questions effectively:

  • Read the question carefully and focus on the core concept being asked.
  • Reference examples and data from the chapter when answering questions about Molecular Basis of Inheritance.
  • Review previous year question papers to get an idea of how such questions may be framed in exams.
  • Practice answering questions within the time limit to improve your speed and accuracy.
  • Discuss your answers with your teachers or peers to get feedback and improve your understanding.

Important Questions & Answers

What is the correct answer to: If the sequence of one strand of DNA is written as follows: 5-ATGCATGCATGCATGCATGCATGCATGC-3 Write down the sequence of complementary strand in 5→3 direction?

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complement...

How do you solve If the sequence of one strand of DNA is written as follows: 5-ATGCATGCATGCATGCATGCATGCATGC-3 Write down the sequence of complementary strand in 5→3 direction step by step?

Step-by-step explanation:
• The DNA strands are complementary to each other with respect to base sequence
• Hence, if the sequence of one strand of DNA is
•
• 5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
•

Why is this answer important for exams?

This question is important because it tests key concepts from the NCERT syllabus and is frequently asked in CBSE exams.

Which NCERT concept is used in this question?

This question is based on core NCERT concepts explained in the chapter and should be revised thoroughly before exams.

What common mistakes should be avoided in this question?

Students often lose marks by skipping steps, writing incomplete explanations, or misunderstanding keywords used in the question.

Latest Blog Posts

Stay updated with our latest educational content and study tips

Home Loan vs Savings: Compare the Costs Before Buying a Home

Home Loan vs Savings: Compare the Costs Before Buying a Home

Pay upfront, or pay off less and over time? The truth depends on four factors most consumers will never compare at the same time: the interest rate on the house loan, the interest rate on the savings account, the rate of home price appreciation, and the cost of renting the home until you actually buy … Read more

Read More
Business After 30 or a Stable Job: Which Path Should You Choose?

Business After 30 or a Stable Job: Which Path Should You Choose?

Thirty is when the question starts to get raised and you’re able to do something because you know you have the experience—you know you have the responsibility. Here are some ways to consider the choice based on a realistic assessment without idealizing either aspect. Restlessness is one of those things that appears in your early … Read more

Read More
How to Return to Work After a Career Break: Skills, Jobs and Preparation in 2026

How to Return to Work After a Career Break: Skills, Jobs and Preparation in 2026

It’s not about starting over if you took a break to care for children, take care of yourself, be healthy or for any other reason. This is a realistic strategy for the recovery of skills, selection of the right job, and overcoming the resume problem. One year, three years or 10 years of a career … Read more

Read More
Best Career Options After Class 12 for Average Students in 2026

Best Career Options After Class 12 for Average Students in 2026

There’s no need to score 95% or achieve a JEE/NEET rank. You don’t need to score 95% or rank in JEE/NEET to build a solid career. A candid and pragmatic guide to the routes that actually work for students who have an average mark and what to do when faced with the options. ​ If … Read more

Read More

Student Discussion

Be the first to comment.

ADD NEW COMMENT

        Can’t find your school? Type full name and submit.