If the sequence of one strand of DNA is | Class 12 Biology Chapter Molecular Basis of Inheritance, Molecular Basis of Inheritance NCERT Solutions

Question: If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5→3 direction
Answer:

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3’


< Previous Question

Next Question >

Study Tips for Answering NCERT Questions:

NCERT questions are designed to test your understanding of the concepts and theories discussed in the chapter. Here are some tips to help you answer NCERT questions effectively:

  • Read the question carefully and focus on the core concept being asked.
  • Reference examples and data from the chapter when answering questions about Molecular Basis of Inheritance.
  • Review previous year question papers to get an idea of how such questions may be framed in exams.
  • Practice answering questions within the time limit to improve your speed and accuracy.
  • Discuss your answers with your teachers or peers to get feedback and improve your understanding.

Comments

Comment(s) on this Question

Welcome to the NCERT Solutions for Class 12 Biology - Chapter . This page offers a step-by-step solution to the specific question from Excercise 1 , Question 3: If the sequence of one strand of DNA is written as follows: 5-ATGCATGCATGCATGCATGCATGCATGC-3 Write d....

Chapters for Class 12 Biology

Subjects for Class 12


Notice: Undefined index: pageType in /var/www/html/ss_beta/saralstudy/ss_new/web/template/common/class_sidebar.php on line 45

Students Also Read

Important links

Quick Links

Resources

Support